Sequence ID | >SRA1015611 |
Genome ID | SRR023846.132234 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 227 |
End posion on genome | 155 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
nnnnnttact |
tRNA gene sequence |
GCCTCCATAGCTCAACGGAAGAGCGAGTGTTTTCTAGGCACCAGGCTGCGGGTTCGAATC |
Downstream region at tRNA end position |
gcactgccga |
Secondary structure (Cloverleaf model) | >SRA1015611 Arg TCT t ACtt gcactgccga G - C C - G C - G T + G C - G C - G A - T T A T C G T C C A A A A | | + | | G C C T C G G C G G G C G | | | | T T G G A G C A A G AGGCT A C G - C T - A G - C T + G T G T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |