Sequence ID | >SRA1015635 |
Genome ID | SRR023846.140534 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 132 |
End posion on genome | 207 |
Amino Acid | Ile |
Anticodon | GAT |
Upstream region at tRNA start position |
aaaatccttt |
tRNA gene sequence |
GCGCTCATGGCCAAACTGGTGAAGGCACTTCGCTGATAACGAAGAGATGTGTTGGTTCGA |
Downstream region at tRNA end position |
gggcgtaact |
Secondary structure (Cloverleaf model) | >SRA1015635 Ile GAT t ACtg gggcgtaact G - C C - G G - C C - G T - A C - G A - T C A T C A A C C A C A A G | | | | | G T A C C G G T T G G C G | | | T T G A G G C T G A A AGATGT C - G T - A T - A C - G G - C C A T A G A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |