Sequence ID | >SRA1015638 |
Genome ID | SRR023846.141701 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 211 |
End posion on genome | 139 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
agctattgct |
tRNA gene sequence |
GGTCTTATGGTGTAATGGTTAGCACTCTGGACTCTGAATCCAGCGATCCGGGTTCAAATC |
Downstream region at tRNA end position |
tttgcgctgc |
Secondary structure (Cloverleaf model) | >SRA1015638 Gln CTG t TCgt tttgcgctgc G - C G - C T - A C - G T + G T - A A - T T A T G G C C C A T A A G | | | | | A G T G T G C C G G G C G + | | | T T T G C A C T A T CGAT C - G T - A G - C G - C A - T C A T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |