| Sequence ID | >SRA1015641 |
| Genome ID | SRR023846.142875 |
| Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
| Species | |
| Start position on genome | 85 |
| End posion on genome | 168 |
| Amino Acid | Leu |
| Anticodon | TAA |
| Upstream region at tRNA start position |
tatattttaa |
| tRNA gene sequence |
GCCTACTTGGTGAAATTGGTAAACACGATAGATTTAAAATCTGTTCCCATGTTAGGGTTA |
| Downstream region at tRNA end position |
tatttattat |
| Secondary structure (Cloverleaf model) | >SRA1015641 Leu TAA
a Attt tatttattat
G + T
C - G
C - G
T - A
A - T
C - G
T - A T G
T T A A C C A
T A A G | | | | | A
T A G T G A T T G G C
G | | | T T
G A C A C
T A A G TCCCATGTTAGGGTT
A - T
T + G
A - T
G - C
A - T
T A
T A
T A A
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |