Sequence ID | >SRA1015641 |
Genome ID | SRR023846.142875 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 85 |
End posion on genome | 168 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
tatattttaa |
tRNA gene sequence |
GCCTACTTGGTGAAATTGGTAAACACGATAGATTTAAAATCTGTTCCCATGTTAGGGTTA |
Downstream region at tRNA end position |
tatttattat |
Secondary structure (Cloverleaf model) | >SRA1015641 Leu TAA a Attt tatttattat G + T C - G C - G T - A A - T C - G T - A T G T T A A C C A T A A G | | | | | A T A G T G A T T G G C G | | | T T G A C A C T A A G TCCCATGTTAGGGTT A - T T + G A - T G - C A - T T A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |