Sequence ID | >SRA1015674 |
Genome ID | SRR023846.153554 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 50 |
End posion on genome | 123 |
Amino Acid | Val |
Anticodon | AAC |
Upstream region at tRNA start position |
cctcccatcg |
tRNA gene sequence |
GATTCCGTGGTGTAGCGGTTATCACATCTGCCTAACACGCAGAAGGTCCCCAGTTCGATC |
Downstream region at tRNA end position |
tttttctgca |
Secondary structure (Cloverleaf model) | >SRA1015674 Val AAC g ACat tttttctgca G - C A - T T - A T - A C - G C - G G - C C T T G G G T C A C G A G | | | | | G G T G T G C C C A G C G | | | T T T T C A C T A A AGGTC T - A C - G T - A G - C C - G C C T A A A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |