Sequence ID | >SRA1015686 |
Genome ID | SRR023846.158462 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 139 |
End posion on genome | 225 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
tggccccttt |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTAAAGGCAGCAGACTGTAAATCTGCCCGGGTTTCCCGTACG |
Downstream region at tRNA end position |
aagctttgcg |
Secondary structure (Cloverleaf model) | >SRA1015686 Tyr GTA t ACCA aagctttgcg G - C G - C A - T C - G A - T G - C G - C T A T C G A C C A T G A G | | | | | G G G C C G G C T G G C G | | | T T T A G G C T A A A CCGGGTTTCCCGTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |