Sequence ID | >SRA1015689 |
Genome ID | SRR023846.158871 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 147 |
End posion on genome | 58 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccgtgcaaca |
tRNA gene sequence |
GGAAGCGTGGCCGAGTGGTTGAAGGCAGCAGTCTTGAAAACTGCCGACGGTGTGAGCCGT |
Downstream region at tRNA end position |
aaatttagaa |
Secondary structure (Cloverleaf model) | >SRA1015689 Ser TGA a GCCA aaatttagaa G - C G - C A - T A - T G - C C - G G - C T A T C A C T C A T G A G | | | | | G G G C C G G T G A G C G | | | T T T A G G C T G A A CGACGGTGTGAGCCGTTC G - C C - G A - T G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |