Sequence ID | >SRA1015716 |
Genome ID | SRR023846.169069 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 151 |
End posion on genome | 236 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
atccactaca |
tRNA gene sequence |
GGAGAGGTGTCAGAGTGGTCGATCGAGCACGCTTGGAAAGCGTGTGTACTGCAAGGTACC |
Downstream region at tRNA end position |
taaacagtca |
Secondary structure (Cloverleaf model) | >SRA1015716 Ser GGA a GCat taaacagtca G - C G - C A - T G - C A - T G - C G - C T A T C G C C C A T G A G | | | | | G G G A C T G C G G G C G + | | T T T T C G A C G A G TGTACTGCAAGGTACC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |