| Sequence ID | >SRA1015717 |
| Genome ID | SRR023846.169549 |
| Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
| Species | |
| Start position on genome | 120 |
| End posion on genome | 192 |
| Amino Acid | Val |
| Anticodon | GAC |
| Upstream region at tRNA start position |
gcgctccggc |
| tRNA gene sequence |
GGGCGTGTAGCTCAGTGGTAGAGCACTGTGTTGACATCGCAGGGGTCGCAAGTTCAATCC |
| Downstream region at tRNA end position |
ggaattgacc |
| Secondary structure (Cloverleaf model) | >SRA1015717 Val GAC
c ACat ggaattgacc
G - C
G - C
G - C
C - G
G - C
T - A
G - C C T
T C G T T C A
G A A | | | | | A
T C T C G G C A A G C
G | | | | T T
G G A G C
T A A GGGTC
C - G
T - A
G - C
T + G
G - C
T T
T A
G A C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |