Sequence ID | >SRA1015726 |
Genome ID | SRR023846.173391 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 34 |
End posion on genome | 105 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
ttaacaaatc |
tRNA gene sequence |
GGGTGATTGGTCTAGTGGTATGATTCTTGCTTTGGGTGCAAGAGGTCGCGAGTTCGATTC |
Downstream region at tRNA end position |
attttttttt |
Secondary structure (Cloverleaf model) | >SRA1015726 Pro TGG c Ctat attttttttt G - C G - C G - C T - A G - C A - T T - A T T T C G C T C A G A G | | | | | G T T C T G G C G A G C G | | + T T G T G A T T A T AGGTC C - G T - A T - A G - C C - G T T T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |