Sequence ID | >SRA1015727 |
Genome ID | SRR023846.173391 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 266 |
End posion on genome | 185 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
gagaagcaaa |
tRNA gene sequence |
GGCACTGTGTCCGAGTGGTTAAGGAGTTGGTTTTGAAAGCCAATGGGCTCTGCCCGCGCG |
Downstream region at tRNA end position |
tttgatttgt |
Secondary structure (Cloverleaf model) | >SRA1015727 Ser TGA a Gatt tttgatttgt G - C G + T C - G A - T C - G T + G G - C T A T T G C T C A T G A G + | | | | A G G C C T G C G A G C G | | | T T T A G G A T A G TGGGCTCTGCCCGC T - A T - A G - C G - C T + G T A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |