Sequence ID | >SRA1015746 |
Genome ID | SRR023846.179993 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 86 |
End posion on genome | 158 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cttgttttgt |
tRNA gene sequence |
GCTGGCTTAGCTCAATTGGTAGAGCAGCTGATTTGTAATCAGCAGGTTGCGGGTTCGAGT |
Downstream region at tRNA end position |
tttttctacg |
Secondary structure (Cloverleaf model) | >SRA1015746 Thr TGT t Ttac tttttctacg G - C C - G T - A G - C G + T C - G T - A T G T T A C C C A T A A A + | | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |