Sequence ID | >SRA1015754 |
Genome ID | SRR023846.182106 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 249 |
End posion on genome | 173 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cgcgccactt |
tRNA gene sequence |
GGCTACATAGCTCAGTTGGTTAGAGCATAGCATTCATAATGCTGGGGTCCGGGGTTCAAG |
Downstream region at tRNA end position |
agtacctgtt |
Secondary structure (Cloverleaf model) | >SRA1015754 Met CAT t ACCA agtacctgtt G - C G - C C - G T - A A - T C - G A - T T G T G T C C C A T G A A | + | | | A T C T C G C G G G G C G | | | | T T G G A G C T T A A GGGTC T + G A - T G - C C - G A - T T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |