Sequence ID | >SRA1015756 |
Genome ID | SRR023846.182967 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 210 |
End posion on genome | 134 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
aaggctcagc |
tRNA gene sequence |
GCCGGTTTAGCTCAGCTTGGTAGAGCAACCGCCTTGTAAGCGGTAGGTCGCGAGTTCAAG |
Downstream region at tRNA end position |
ctttttccga |
Secondary structure (Cloverleaf model) | >SRA1015756 Thr TGT c ACCA ctttttccga G - C C - G C - G G - C G - C T - A T - A T G T C G C C C A C G A A | | | | A T C T C G G C G A G C T | | | | T T G G A G C G T A A AGGTC A - T C - G C - G G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |