Sequence ID | >SRA1015759 |
Genome ID | SRR023846.184664 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 34 |
End posion on genome | 108 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taacctaccc |
tRNA gene sequence |
GGCGGGGTAGCTCAGATGGTTAGAGCGCAGGATTCATAACCCTGAGGTCGGCAGTTCGAT |
Downstream region at tRNA end position |
gaaagggcaa |
Secondary structure (Cloverleaf model) | >SRA1015759 Met CAT c ACtg gaaagggcaa G + T G - C C - G G - C G - C G - C G - C C T T T C G T C A A G A A + | | | | G T C T C G G G C A G C G | | | | T T G G A G C T T A G AGGTC C - G A - T G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |