Sequence ID | >SRA1015773 |
Genome ID | SRR023846.193359 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 104 |
End posion on genome | 29 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ccgggcgcat |
tRNA gene sequence |
GCGGCTGTAGCTCAGTGGATAGAGTATTGGCCTCCGAAGCCAAGGGTCGTGGGTTCGATC |
Downstream region at tRNA end position |
gtttttcact |
Secondary structure (Cloverleaf model) | >SRA1015773 Arg CCG t ACCA gtttttcact G - C C - G G - C G - C C - G T - A G - C C T T C G C C C A T G A A | + | | | G G C T C G G T G G G C G | | | + T T A G A G T T A A GGGTC T - A T - A G - C G - C C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |