Sequence ID | >SRA1015774 |
Genome ID | SRR023846.193740 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 127 |
End posion on genome | 200 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
aaagttcatt |
tRNA gene sequence |
AGGGGCGTTTTCTAATGGCAAGAATCTGGTCTCCAAAACCAGCTATGGGGGTTCGAGTCC |
Downstream region at tRNA end position |
aacacatcga |
Secondary structure (Cloverleaf model) | >SRA1015774 Trp CCA t GCCA aacacatcga A - T G - C G - C G - C G - C C - G G - C T G T C T C C C A A A T | + | | | G T T C T T G G G G G C G | | | | T T G A G A A C A T CTAT C - G T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |