Sequence ID | >SRA1015776 |
Genome ID | SRR023846.194360 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 127 |
End posion on genome | 199 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
caaggattaa |
tRNA gene sequence |
GCCGTTTTAGCTCAGTGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCATGGGTTCAAATC |
Downstream region at tRNA end position |
caaatacggt |
Secondary structure (Cloverleaf model) | >SRA1015776 Thr GGT a TCag caaatacggt G - C C - G C - G G + T T - A T - A T - A T A T T A C C C A G A A | | | | | A T C T C G A T G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |