Sequence ID | >SRA1015783 |
Genome ID | SRR023846.198563 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 107 |
End posion on genome | 34 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
tgacggcaaa |
tRNA gene sequence |
GGGGCTGTGGCGCAGTTGGTAGCGCGTCTCGTTCGCATCGAGAAGGTCAGGGGTTCGATT |
Downstream region at tRNA end position |
cgcaatggat |
Secondary structure (Cloverleaf model) | >SRA1015783 Ala CGC a ACac cgcaatggat G - C G - C G + T G - C C - G T - A G - C T T T T C C C C A T G A G | | | | | G T C G C G A G G G G C G | | | | T T G G C G C T A G AGGTC T - A C - G T - A C - G G - C T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |