Sequence ID | >SRA1015791 |
Genome ID | SRR023846.201380 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 121 |
End posion on genome | 195 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
catcatgcaA |
tRNA gene sequence |
GCCCGATTAACTCAGTCGGTAGAGTGACAGGCTCTTAACCTGCTAGTCGCGGGTTCGAGC |
Downstream region at tRNA end position |
ttttattttt |
Secondary structure (Cloverleaf model) | >SRA1015791 Lys CTT A TAat ttttattttt G - C C - G C - G C - G G - C A - T T - A C G T C G C C C A T G A A | | | | | G C C T C A G C G G G C G | | | | T T G G A G T T A G TAGTC A C C - G A - T G - C G - C C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |