Sequence ID | >SRA1015806 |
Genome ID | SRR023846.207499 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 41 |
End posion on genome | 111 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aataagctga |
tRNA gene sequence |
GCGTCGGTGGTTCAATGGTAGAATTCTCGCCTGCCACGCGGGAGGTCCGGGTTCGATTCC |
Downstream region at tRNA end position |
ttaattttta |
Secondary structure (Cloverleaf model) | >SRA1015806 Gly GCC a Aatt ttaattttta G - C C - G G - C T - A C - G G - C G - C T T T G G C C C A A A G | | | | | G T C T T G C C G G G C G | | | + T T G G A A T T A T AGGT C - G T + G C - G G - C C - G C C T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |