Sequence ID | >SRA1015807 |
Genome ID | SRR023846.207793 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 167 |
End posion on genome | 92 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
accgcccgtt |
tRNA gene sequence |
GCCCAGGTAGCTCAGTTGGTAGAGCATGCGACTGAAAATCGCAGTGTCGGCGGTTCGATC |
Downstream region at tRNA end position |
tttttacttt |
Secondary structure (Cloverleaf model) | >SRA1015807 Phe GAA t ACCA tttttacttt G - C C - G C - G C - G A - T G - C G + T C T T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC T - A G - C C - G G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |