Sequence ID | >SRA1015815 |
Genome ID | SRR023846.209747 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 79 |
End posion on genome | 154 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tagagatatg |
tRNA gene sequence |
GTGGCTATAGCTCAGTTGGTAGAGCCCTGGATTGTGATTCCAGTTGTCGTGGGTTCGAGC |
Downstream region at tRNA end position |
ctctaaaaat |
Secondary structure (Cloverleaf model) | >SRA1015815 His GTG g CCCA ctctaaaaat G - C T - A G - C G - C C - G T - A A - T C G T T A C C C A T G A A + | | | | G T C T C G G T G G G C G | | | | T T G G A G C T A C TTGTC C - G T - A G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |