Sequence ID | >SRA1015826 |
Genome ID | SRR023846.216017 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 231 |
End posion on genome | 155 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ggtttcagtg |
tRNA gene sequence |
GTGGCTGTAGCTCAGCTGGTTAGAGTACTGGATTGTGATTCCAGATGTCGGGGGTTCGAG |
Downstream region at tRNA end position |
ctgattgcag |
Secondary structure (Cloverleaf model) | >SRA1015826 His GTG g CCCA ctgattgcag G - C T - A G - C G - C C - G T - A G - C T G T T C C C C A C G A A + | | | | G T C T C G G G G G G C G | | | + T T G G A G T T T A A ATGTC C - G T - A G - C G - C A - T T T T A G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |