Sequence ID | >SRA1015831 |
Genome ID | SRR023846.217064 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 240 |
End posion on genome | 166 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
cgcgtcgccc |
tRNA gene sequence |
CGGGGCGTAGCTCAGCTTGGTAGAGCGCCCGCTTTGGGAGCGGGAGGCCGCAGGTTCAAA |
Downstream region at tRNA end position |
cacggcccca |
Secondary structure (Cloverleaf model) | >SRA1015831 Pro TGG c ACgt cacggcccca C - G G - C G - C G - C G - C C - G G - C T A T T G T C C A C G A A + | | | | A T C T C G G C A G G C T | | | | T T G G A G C G T A G AGGCC C - G C - G C - G G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |