Sequence ID | >SRA1015837 |
Genome ID | SRR023846.220540 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 70 |
End posion on genome | 154 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
tccgccccgt |
tRNA gene sequence |
GCCCAGGTGGCGGAATTGGTAGACGCGCACGGTTCAGGTCCGTGTGCCGCGAGGCGTGAA |
Downstream region at tRNA end position |
atttccctga |
Secondary structure (Cloverleaf model) | >SRA1015837 Leu CAG t ACCA atttccctga G - C C - G C - G C - G A - T G - C G - C T G T T T T C C A T A A G + | | | | G T G G C G G A A G G C G | | | T T G A C G C T A G G TGCCGCGAGGCGT C - G A - T C - G G - C G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |