Sequence ID | >SRA1015839 |
Genome ID | SRR023846.222496 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 173 |
End posion on genome | 82 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gacggcctgc |
tRNA gene sequence |
GGAGACGTGGCCGAGCGGCTGAAGGCACTCGTTTGCTAAATGAGCATACCCCGAAAGGGG |
Downstream region at tRNA end position |
tttacgacaa |
Secondary structure (Cloverleaf model) | >SRA1015839 Ser GCT c GCCA tttacgacaa G - C G - C A - T G - C A - T C - G G - C T A T C T C C C A C G A G | | | | | G G G C C G G A G G G C G | | | T T C A G G C T G A A CATACCCCGAAAGGGGTATC C - G T - A C - G G + T T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |