Sequence ID | >SRA1015842 |
Genome ID | SRR023846.224582 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 118 |
End posion on genome | 191 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
tagtaagcaa |
tRNA gene sequence |
TCCTGGATGGCGCAATCGGTAGCGCGCCCGGCTGTTAACCGGTAGGTTGTGAGTTCGAGT |
Downstream region at tRNA end position |
tttttaaaaa |
Secondary structure (Cloverleaf model) | >SRA1015842 Asn GTT a GCtt tttttaaaaa T - A C - G C - G T + G G - C G + T A - T T G T C A C T C A T A A G | | | | | G C C G C G G T G A G C G | | | | T T G G C G C T A G AGGTT C T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |