Sequence ID | >SRA1015846 |
Genome ID | SRR023846.225703 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 181 |
End posion on genome | 256 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cggagaagtt |
tRNA gene sequence |
GGCAACATAGCTCAGTTGGTAGAGCACAGCACTGAAAATGCTGGTGTCGTTGGTTCGATT |
Downstream region at tRNA end position |
aagaaaggcc |
Secondary structure (Cloverleaf model) | >SRA1015846 Phe GAA t ACAA aagaaaggcc G - C G - C C - G A - T A - T C - G A - T T T T C A A C C A T G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T A A GTGTC C - G A - T G - C C - G A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |