Sequence ID | >SRA1015850 |
Genome ID | SRR023846.227358 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 39 |
End posion on genome | 112 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gtgtcgtgct |
tRNA gene sequence |
TCTCCTATAGCTCAGTTGGTAGAGCGTGCGGCTGTTAACCTCAAGGTCGCTGGTTCAAAC |
Downstream region at tRNA end position |
cttttactac |
Secondary structure (Cloverleaf model) | >SRA1015850 Asn GTT t GCtt cttttactac T - A C - G T - A C - G C - G T + G A - T C A T C G A C C A T G A A | | | | | A T C T C G G C T G G C G | | | | T T G G A G C T A G AGGTC T - A G - C C T G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |