Sequence ID | >SRA1015858 |
Genome ID | SRR023846.231835 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 65 |
End posion on genome | 139 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cttagcgttt |
tRNA gene sequence |
GCTCCCTTCGTCTATCGGTTAGGACGCCACCCTTTCACGGTGGAGAGAGCGGTTCGATTC |
Downstream region at tRNA end position |
cccgcgcgac |
Secondary structure (Cloverleaf model) | >SRA1015858 Glu TTC t GCCA cccgcgcgac G - C C - G T - A C - G C - G C - G T - A T T T T C G C C A C T A C | | | | | G G T C T G A G C G G C G + | | | T T T G G A C T A G AGAG C - G C - G A - T C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |