Sequence ID | >SRA1015867 |
Genome ID | SRR023846.234034 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 144 |
End posion on genome | 234 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
tgccccttgc |
tRNA gene sequence |
GGAGAGGTGGCCGAGTGGCCGAAGGCGCTCGATTCGAAATCGAGTAGACTGCAAAACAGT |
Downstream region at tRNA end position |
ctttctttcc |
Secondary structure (Cloverleaf model) | >SRA1015867 Ser CGA c GCCA ctttctttcc G - C G - C A - T G - C A - T G - C G - C T A T C A C C C A T G A G | | | | | A G G C C G G T G G G C G | | | T T C A G G C C G A G TAGACTGCAAAACAGTCTC C - G T - A C - G G - C A - T T A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |