Sequence ID | >SRA1015870 |
Genome ID | SRR023846.235702 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 61 |
End posion on genome | 147 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
cctacccagt |
tRNA gene sequence |
GCCCGGATGGCGGAATTGGTAGACGCACCAGCTTCAGGTGCTGGCGATCGCAGGGTCGTG |
Downstream region at tRNA end position |
gtctttagac |
Secondary structure (Cloverleaf model) | >SRA1015870 Leu CAG t ACCA gtctttagac G - C C - G C - G C - G G - C G - C A - T T G T T C T C C A T A A G + | | | | G T G G C G G G A G G C G | | | T T G A C G C T A G A CGATCGCAGGGTCGT C - G C - G A - T G - C C - G T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |