Sequence ID | >SRA1015872 |
Genome ID | SRR023846.236191 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 226 |
End posion on genome | 155 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tccctcgtga |
tRNA gene sequence |
TCCGGTATGGTCTAGTGGTTAGGATTTCTGGCTTTCACCCAGGAGGCTCGGGTTCGATTC |
Downstream region at tRNA end position |
tttgcacgcc |
Secondary structure (Cloverleaf model) | >SRA1015872 Glu TTC a Atgt tttgcacgcc T - A C - G C - G G - C G - C T - A A - T T T T G G C C C A T G A G + | | | | G G T C T G T C G G G C G + | | + T T T G G A T T A T AGGC T + G C - G T - A G - C G - C C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |