| Sequence ID | >SRA1015877 |
| Genome ID | SRR023846.237524 |
| Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
| Species | |
| Start position on genome | 158 |
| End posion on genome | 82 |
| Amino Acid | Met |
| Anticodon | CAT |
| Upstream region at tRNA start position |
cgccggacac |
| tRNA gene sequence |
CGCGGGGTGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCACAGGTTCAAA |
| Downstream region at tRNA end position |
acctcatttg |
| Secondary structure (Cloverleaf model) | >SRA1015877 Met CAT
c ACCA acctcatttg
C A
G - C
C - G
G - C
G - C
G - C
G - C T A
T T G T C C A
C G A G | | | | | A
C C G A G A C A G G C
C | | | | T T
G G C T C
G T A G AGGTC
T - A
C - G
A - T
G - C
G - C
C A
T A
C A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |