Sequence ID | >SRA1015886 |
Genome ID | SRR023846.241940 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 54 |
End posion on genome | 129 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cggttgccat |
tRNA gene sequence |
TCCTCGATAGCTCAATTGGCAGAGCAGCCGGCTGTTAACCGGCAGGTTGTTGGTTCGAGT |
Downstream region at tRNA end position |
aggcccagag |
Secondary structure (Cloverleaf model) | >SRA1015886 Asn GTT t GCGA aggcccagag T - A C - G C - G T + G C - G G - C A - T T G T C A A C C A T A A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C C A A AGGTT G - C C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |