Sequence ID | >SRA1015892 |
Genome ID | SRR023846.245306 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 161 |
End posion on genome | 237 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tactagctgt |
tRNA gene sequence |
CGGGGCGTAGCGCAGCCTGGTAGCGCATCTGCTTTGGGAGCAGAGGGTCGTGAGTTCGAA |
Downstream region at tRNA end position |
ccattcaaaa |
Secondary structure (Cloverleaf model) | >SRA1015892 Pro TGG t ACCA ccattcaaaa C - G G - C G - C G - C G - C C - G G - C T A T C A C C C A C G A A | | | | G C C G C G G T G A G C T | | | | T T G G C G C G T A A GGGTC T - A C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |