Sequence ID | >SRA1015903 |
Genome ID | SRR023846.250800 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 56 |
End posion on genome | 136 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
agagtgctag |
tRNA gene sequence |
GACAGCTTGGCCGAGCGGTTAAGGCGATAGACTCGAAATCTATTGGGGTAACCCGCGTGA |
Downstream region at tRNA end position |
aatctatttc |
Secondary structure (Cloverleaf model) | >SRA1015903 Ser CGA g Gatc aatctatttc G - C A - T C - G A - T G - C C - G T - A T G T C A C T C A C G A G | | | | | A G G C C G G T G A G C G | | | T T T A G G C T A G TGGGGTAACCCGC A - T T - A A - T G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |