Sequence ID | >SRA1015904 |
Genome ID | SRR023846.250868 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 102 |
End posion on genome | 184 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
tgtttgcgtT |
tRNA gene sequence |
GGTCAATTGGCCGAGCGGTCTAAGGCGCCAGTTTAAGGCACTGGTCTGAAAGGGCGTGGG |
Downstream region at tRNA end position |
ccttctttct |
Secondary structure (Cloverleaf model) | >SRA1015904 Leu AAG T AGCt ccttctttct G - C G - C T + G C - G A - T A - T T - A T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C C T A G TCTGAAAGGGC C - G C - G A - T G - C T - A T C T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |