Sequence ID | >SRA1015915 |
Genome ID | SRR023846.259697 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 10 |
End posion on genome | 102 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
nggcggctca |
tRNA gene sequence |
GGAACTGTGACCGAGTGGCCGAAGGTGCTCCCCTGCTAAGGGAGTATGGGGTGTAGAGCC |
Downstream region at tRNA end position |
gacagctagc |
Secondary structure (Cloverleaf model) | >SRA1015915 Ser GCT a GCCA gacagctagc G - C G - C A - T A - T C - G T + G G - C T A T C T C C C A T G A G | | | | | G G G C C A G A G G G C G | | | T T C A G G T C G A G TATGGGGTGTAGAGCCTCATC C - G T - A C - G C - G C - G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |