Sequence ID | >SRA1015921 |
Genome ID | SRR023846.263730 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 212 |
End posion on genome | 141 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tataagcgtc |
tRNA gene sequence |
GGCGGTATGGTGTAATGGTTAGCACATCAGATTTTGACTCTGGGAATCTCGGTTCGATTC |
Downstream region at tRNA end position |
cacctttttt |
Secondary structure (Cloverleaf model) | >SRA1015921 Gln TTG c Tact cacctttttt G - C G - C C - G G + T G - C T - A A - T T T T G G G C C A T A A G | + | | | G G T G T G C T C G G C G + | | | T T T G C A C T A A GAAT T + G C - G A - T G - C A - T T C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |