Sequence ID | >SRA1015930 |
Genome ID | SRR023846.268429 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 114 |
End posion on genome | 196 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
cgtctaacat |
tRNA gene sequence |
GCTCCTGTGGTGAAATTGGCATACACGCTTGACTTAAAATCAAGTGCCGCAAGGATTGTG |
Downstream region at tRNA end position |
gacacaaata |
Secondary structure (Cloverleaf model) | >SRA1015930 Leu TAA t ACac gacacaaata G + T C - G T - A C - G C - G T - A G - C T G T C A C C C A T A A G | | | | | G T A G T G G T G G G C G | | | T T G A C A C C A T G TGCCGCAAGGATT C - G T - A T - A G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |