Sequence ID | >SRA1015932 |
Genome ID | SRR023846.269629 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 135 |
End posion on genome | 206 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
atccagttaa |
tRNA gene sequence |
ATCGCGGTAGCTCAATGGTCAGAGCGTTTCATTCATAACGTAAAAGTATAGGTTCGATTC |
Downstream region at tRNA end position |
aattttctta |
Secondary structure (Cloverleaf model) | >SRA1015932 Met CAT a Aatt aattttctta A - T T - A C - G G - C C - G G - C G - C T T T T G T C C A T A A A | + | | | G G C T C G A T A G G C G | | | | T T T G A G C C A G AAGT T - A T - A T T C - G A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |