Sequence ID | >SRA1015955 |
Genome ID | SRR023846.282969 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 74 |
End posion on genome | 148 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ccgtcagaca |
tRNA gene sequence |
GCGCCCTTCGTCTATCGGTTAGGACGTCAGCCTTTCACGCTGAAAAGGCGGGTTCGATTC |
Downstream region at tRNA end position |
ttcccctctg |
Secondary structure (Cloverleaf model) | >SRA1015955 Glu TTC a GCCA ttcccctctg G - C C - G G - C C - G C - G C - G T - A T T T C G C C C A C T A C | | | | | G G T C T G G C G G G C G + | | | T T T G G A C T A G AAAG T - A C - G A - T G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |