Sequence ID | >SRA1015961 |
Genome ID | SRR023846.285528 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 67 |
End posion on genome | 140 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gatacggcat |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCTTTTGCTTCCCAAGCAAGTGACGAGGGTTCGATTCC |
Downstream region at tRNA end position |
catttgcgct |
Secondary structure (Cloverleaf model) | >SRA1015961 Gly CCC t TCCA catttgcgct G - C C - G G - C G - C G - C T - A G - C T T T T T C C C A A A A + | | | | G T C T C G G A G G G C G | | | | T T G G A G C T A T TGAC T + G T - A T - A G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |