Sequence ID | >SRA1015978 |
Genome ID | SRR023846.292220 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 97 |
End posion on genome | 184 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ggtccggcgc |
tRNA gene sequence |
GGAGGATTCGCCTAGTGGCCTATGGCGCTCGCTTGGAAAGCGGGTTGGGTTAACGCCCTC |
Downstream region at tRNA end position |
ctcttgcccc |
Secondary structure (Cloverleaf model) | >SRA1015978 Ser GGA c GCCA ctcttgcccc G - C G - C A - T G - C G - C A - T T - A T A T T C C C C A T G A C | | | | | G G T C C G A G G G G C G | | | T T C T G G C C T A G TTGGGTTAACGCCCTC C - G T + G C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |