Sequence ID | >SRA1015979 |
Genome ID | SRR023846.292388 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 87 |
End posion on genome | 162 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ccccagaagt |
tRNA gene sequence |
GCCCTTGTAGCTCAGTTGGTAGAGCACCTGATTTGTAATCAGGGGGTCACGAGTTCGAAC |
Downstream region at tRNA end position |
cttctatccc |
Secondary structure (Cloverleaf model) | >SRA1015979 Thr TGT t ACCA cttctatccc G - C C - G C - G C - G T + G T + G G - C C A T T G T T C A T G A A | | + | | G T C T C G A C G A G C G | | | | T T G G A G C T A A GGGTC C - G C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |