Sequence ID | >SRA1015981 |
Genome ID | SRR023846.292971 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 171 |
End posion on genome | 244 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
accgtatcga |
tRNA gene sequence |
GGCGCGATGGCGGAGTGGTGACGCAGAGGACTGCAAATCCTTGCACCCGGGTTCGATTCC |
Downstream region at tRNA end position |
acggacggnn |
Secondary structure (Cloverleaf model) | >SRA1015981 Cys GCA a TCCA acggacggnn G - C G - C C - G G - C C - G G - C A - T T T T G G C C C A G A G | | | | | G T G G C G C C G G G C G | | | T T G A C G C T G A GCAC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |