Sequence ID | >SRA1016055 |
Genome ID | SRR023846.326670 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 215 |
End posion on genome | 140 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
accacattaa |
tRNA gene sequence |
GGTGATGTAGCTCAGTTGGTAGAGCAAAGGACTGAAAATCCTTGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
ccttaacgta |
Secondary structure (Cloverleaf model) | >SRA1016055 Phe GAA a ACCA ccttaacgta G - C G - C T - A G - C A - T T - A G - C T T T C T G C C A T G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC A - T A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |