Sequence ID | >SRA1016096 |
Genome ID | SRR023846.347487 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 176 |
End posion on genome | 252 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tcgcaggtca |
tRNA gene sequence |
CGGAGTGTAGCGCAGCCTGGTAGCGCACCTCGTTCGGGACGAGGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
gcgcaccggt |
Secondary structure (Cloverleaf model) | >SRA1016096 Pro CGG a ACCA gcgcaccggt C - G G - C G - C A - T G - C T - A G - C T A T C G T C C A C G A A | | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G T - A C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |